1. Science
  2. Biology
  3. 5 a novel human cdna has been cloned and nucleotide...

Question: 5 a novel human cdna has been cloned and nucleotide...

Question details

5. A novel human cDNA has been cloned and nucleotide sequence has been determined as shown below 5 tcgatgggggcccccgcttcacgcagctgcagtacataatcggc 3 coding 3 agctacccccgggggcgaagtgcgtcgacgtcatgtattagccg 5 noncoding (template) i) Write down the mRNA sequence that will be produced from this gene indicating the direction (5 to 3) will be translated i) Write down the amino acid sequence in the polypeptide chain that from the mRNA using genetic code dictionary provided in next page. Genetic code Dictionary 10
Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution