Question: design a pcr primer pair that could specifically amplify the...
Question details
Design a PCR primer pair that could specifically amplify the whole DNA sequence below. Use 5 base pair primers and label the 5' and 3' ends of the primers you design.
5' –ACGTTCCTAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAACGGTAGC– 3
Could someone please guide me through the steps of how to solve this PCR problem? I'm at a loss as to where to start
Solution by an expert tutor
