1. Science
  2. Biology
  3. design a pcr primer pair that could specifically amplify the...

Question: design a pcr primer pair that could specifically amplify the...

Question details

Design a PCR primer pair that could specifically amplify the whole DNA sequence below. Use 5 base pair primers and label the 5' and 3' ends of the primers you design.

5' –ACGTTCCTAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAACGGTAGC– 3

Could someone please guide me through the steps of how to solve this PCR problem? I'm at a loss as to where to start

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution