1. Science
  2. Biology
  3. find the mrna sequence and amino acid sequence template strand...

Question: find the mrna sequence and amino acid sequence template strand...

Question details

Find the mRNA sequence and amino acid sequence:

Template strand:

3'CGATGAAGGCTACCAACTAACTTAGTCCCGAGTAAATTCC 5'

Coding Strand:

5’GCTACTTCCGATGGTTGATTGAATCAGGGCTCATTTAAGG 3’

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution