1. Science
  2. Biology
  3. given the template dna sequence below 3ccaccttctatacttcgcggaatgccggtccatgtaggttcacattagcgt5 5 during dna...

Question: given the template dna sequence below 3ccaccttctatacttcgcggaatgccggtccatgtaggttcacattagcgt5 5 during dna...

Question details

Given the template DNA sequence below: 3-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5 5. During DNA replication, a mutation occurred and GTC in the aforementioned sequence (indicated in red color) got deleted from the gene. Write the corresponding DNA template sequence and transcribe the mutated mRNA sequence. Give the amino acid sequence of the resulting mutated protein

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution