1. Science
  2. Biology
  3. given the template dna sequence below 3ccaccttctatacttcgcggaatgccggtccatgtaggttcacattagcgt5 replicate the template...

Question: given the template dna sequence below 3ccaccttctatacttcgcggaatgccggtccatgtaggttcacattagcgt5 replicate the template...

Question details

Given the template DNA sequence below 3-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5 Replicate the template strand above to the corresponding coding strand. Label the 5 and 3 ends in the new strand Transcribe the above template strand to an mRNA sequence Find the start and stop codons on the mRNA and enclose it in a box or label with different color. Write the amino acid sequence of the translation product starting from the start codon, until you encounter a stop codon. Enclose the stop codon with a box During DNA replication, a mutation occurred and GTC in the aforementioned sequence (indicated in red color) got deleted from the gene. Write the corresponding DNA template sequence and transcribe the mutated mRNA sequence. Give the amino acid sequence of the resulting mutated protein An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA. 1. 2. 3. 4. 5. 6.

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution