1. Science
  2. Biology
  3. how would the following dna insertion change the protein coded...

Question: how would the following dna insertion change the protein coded...

Question details

How would the following DNA insertion change the protein coded for by the mRNA sequence? GCUAGAGUAUGUGCGCUAACGGUAAUAAUGUGGAGCUAACUUUGUGACCUUAAA

Transcribe the following mRNA sequence into a protein using the three letter code for each amino acid. (hint, be sure to start at the start codon).


GCUAGAGUAUGUGCGCUAACGGUAUAAUGUGGAGCUAACUUUGUGACCUUAAA

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution