1. Science
  2. Biology
  3. i at nucleotide site 140 the horse and pig have...

Question: i at nucleotide site 140 the horse and pig have...

Question details

i. At nucleotide site 140, the horse and pig have a “G, while all other taxa have an A. . How will we know which nucleotide state is ancestral within Artyodactyls and which is derived? Hint: why did we include a P erissodactyl in this analysis?

ii.From nucleotide site 198221, nucleotides are present for the deer, cow, goat DNA is missing from the horse and Suid lineages. This and sheep. However difference could have either resulted from a large deletion or a large insertion event at some point in the Ungulate evolutionary history. After making your morphological phylogeny, which scenario do you suspect? Why?

Curation results 130 140 150 160 176 180 Equidae(e.g. Ho Suina(e.g. Pig) Cervidae(e.g. D ovidae(e.g. _Co aprinae(e.g. G prinae(e.g. s ACCC TİTTATGC ECC AGTTAG CATACCCATATTATGCAAAGCCA ATACCCATATTATGCAAAGCCA i GCAGTTAGGTCACCTGCCCAAATTCTTC CATACCCATATTATGCAAAGCCATTG CATACCCATATTATG GGTGCAGTTAGGTCACCTGCCCAAATTCTCCAATG GCAGTTAGGTCACCTGCCCAAATTCTTCAG CUTGCAGTTAGGTCACCTGCCCAAACTCTTCAAT 190 210 220 230 240 Equidae(e.g. Ho Suina(e.g. Pig) Cer vidae(e.g. D dae(e.g. Co 호:-- GTGOCCGCCAAGTCCTGCCAAG TGTGCCTGCCAAGTCCTGCOAAGOAG ACCA GCCAAATACG CAACCAACTACCCTGGC CAACT TGCGCCTGCGAAGTCCTGC TGTGCCTGCCAAGTCCTGCCAAGA GcCA prinae(e.g. s TGCCAAATA

Bear JeeX 기,- 1. Foregut Fermentation 2. Hindgut Fermentation 3. Permanent Horns 4. Antiers 5. Lophodont Teeth 6. Selenodont Teeth 7. Loss of Incisors (upper jaw) . Unguligrade Locomotion 2 or 4 Toes .1 or 3 Toes

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution