1. Science
  2. Biology
  3. ii from nucleotide site 198221 nucleotides are present for the...

Question: ii from nucleotide site 198221 nucleotides are present for the...

Question details

ii From nucleotide site 198221, nucleotides are present for the deer, cow, goat This and sheep. However, DNA is missing from the horse and S difference could have either resulted from a large deletion or a large insertion event at some point in the Ungulate evolutionary history. After making your morphological phylogeny, which scenario do you suspect? Why? uid lineages.

Curation results 130 140 150 166 170 180 Equidae(e.g. Ho Suina(e.g. Pig) Cervidae(e.g. D ovidae(e.g. Co rinae(e.g. G aprinae(e-E. S CATACCCATATTATGCAAAGCCA GGTGCAGTTAGGTCACCTGCCCA ACCCATATTATGCAAAGCCAECTGCAGTTAGGTCACCTGCCCAAATTCTTC TACCCATATTATGCAA AGC CAİİ TG CAGT TAGGTCACCTGCCCAAATTC TTC-B CATACCCATATTATGCG AGCCACTTGCAGTTAGGTCACCTECCCAAACTCTTCA 190 200 210 220 230 240 Equidae(e.g. Ho Suina(e.g. Pig) Cer vidae(e.g. D idae(e.g. Co ACC TG GC 5C GCCAAA GTGCCGGCCAAGTOCTGCCAAG TGTGCCTGCCAAGTCCTGCCAAG TGCGCCTGCCAAGTCCTGCCAAG TGTGCCTGCCAAGTOCTGCCAAGA ААСТА CIGCCAACTAC GCC aprinae(e.g._S

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution