1. Science
  2. Biology
  3. phylogenetics problems refer to the dna sequence matrix given...

Question: phylogenetics problems refer to the dna sequence matrix given...

Question details

Phylogenetics problems – refer to the DNA sequence matrix given below

Fern AGCCCAGGCTTCGAATGTCC Pine AGCTTCAGTGTCGCACTTCC Oak AGCTTCAGCGTCACACATCC Moss AACCTTGGTGTCAAACGTCC

4. Assuming that Moss is the outgroup (the species on bottom outside the others), draw all three possible trees of evolutionary relationships among these species. Label your trees A, B, and C. Note – you may draw these by hand.

5. Calculate a genetic distance matrix for these sequences. Based on these values, which tree (A, B, or C) do you think is best under the Genetic Distance criterion?

6. Determine the minimum number of mutations required under the parsimony criterion for each of the three trees. Which is the most parsimonious tree?

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution