1. Science
  2. Biology
  3. please help with part d and e thanks...

Question: please help with part d and e thanks...

Question details
A scientist discovered a noble gene from cancer cells and found to be associated with development of cancerous of cells. The nucleotide sequence of the template strand was determined as written below. Study the sequence and answer the following questions AAACCGACGTACCCCAAATTTGAGCCTGGACACCTTAAGAGCGGGCTCGGAACACTGGCCCCGATTGACAC S 5 A. Write down the sense strand of the gene showing direction B. Write down the nucleotide sequence of the mRNA C How many amino acids will be in polypeptide produced from this mRNA? Write down the amino acid sequence of the polypeptide. Write down the sequence of the neucleotides of the DNA fragments produced from the gene after EcoRi digestion. (EcoRi recognition site is GAATTC) D. E. Write down the sequence of the neucleotides of the mRNA produced from the gene after EcoRI dige stion
A. The sense strand (or coding strand) is complementary to the template strand (or antisense strand). Thus, the sequence of the sense strand will be- B. The mRNA has the same sequence as the coding strand, but the thymine (T) is replaced by uracil (U). Thus, the sequence of mRNA is- 5 UUUGGCUGCAUGGGGUUUAAACUCGGACCUGUGGAAUUCUCGCCCGAGCCUUGUGACCGGGGCUAACUGUG 3 C. Three nucleotides make one codon which codes for one amino acid. The start codon is AUG which also codes for methionine. The stop codons are UAA,UGA and UAG do not code for any amino acid. Thus, the polypeptide produced from this mRNA will have the following 18 amino acids- Met-gly-phe-lys-leu-gly-pro-val-glu-phe-ser-pro-glu-pro-cys-asp-arg-gly Please help with part D and E thanks

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution