1. Science
  2. Biology
  3. problem 1 shown below are the base pairs in a...

Question: problem 1 shown below are the base pairs in a...

Question details

Problem 1 Shown below are the base pairs in a piece of DNA from chromosome I that contains a small gene. Copy the base pairs in these strands of DNA into your notebook. a. 5- TGTCGCGCGCGGATATGAGACCCCTACGGGATATATTAGTTTACGCCCGGCG3 3- ACAGCGCGCGCCTATACTCTGGGGATGCCCTATATAATCAAATGCGGGCCGCs b. The Promoter sequence for the gene is: 5CGcGcGcGG3 зGCGCGCGCCS, Locate and label the promoter in the DNA. c. The Terminator for the gene is: 5GCCC3 3 CGGG5 Locate and label the promoter in the DNA. Describe the function of RNA polymerase d. On the piece of DNA, show where the basal tronscription factors would bind e. J Write down the sequence of nucleotides that would be in the pre-RNA if the gene is transcriber

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution