1. Science
  2. Biology
  3. student name a scientist discovered a noble gene from cancer...

Question: student name a scientist discovered a noble gene from cancer...

Question details

Student Name: A scientist discovered a noble gene from cancer cells and found to be associated with development of cancerous of cells. The nucleotide sequence of the template strand was determined as written below. Study the sequence and answer the following questions. 3 GAGCGGGCTCGGAACACTGGCCCCGATTGACAC 5 A. Write down the sense strand of the gene showing direction. B. Write down the nucleotide sequence of the mRNA. C. How many amino acids will be in polypeptide produced from this mRNA? Write down the amino acid sequence of the polypeptide. D. Write down the sequence of the neucleotides of the DNA fragments produced from the gene after EcoRI digestion. (EcoRI recognition site is GAATTC) E. Write down the sequence of the neucleotides of the mRNA produced from the gene after EcoRI digestion.
Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution