1. Engineering
  2. Computer Science
  3. use python programming language in this question you are given...

Question: use python programming language in this question you are given...

Question details

USE PYTHON PROGRAMMING LANGUAGE

In this question, you are given a string s which represents a DNA string. The string s consists of symbols 'A', 'C', 'G', and 'T'. An example of a length 21 DNA string is "ATGCTTCAGAAAGGTCTTACG."

Your task is to write a code which will count the number of times each of the symbols 'A', 'C', 'G', and 'T' occur in s. Your code should generate a list of 4 integers and print it out.

In [1]
# Here is the DNA string:

s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'


In [2]

# Type your code here

Solution by an expert tutor
Blurred Solution
This question has been solved
Subscribe to see this solution