Question: you are given the sequence of a dna sense coding...

You are given the sequence of a DNA sense (coding) strand below: 5’ GTCAATGCTGAAATCACGGATTCATTAA 3’ A. Copy the DNA sequence to your exam answer-book and write the sequence of the anti-sense strand underneath it, showing the 3’ and 5’ ends. (2 marks) B. Write the mRNA sequence encoded by the given DNA showing the 3’ and 5’ ends. (2 marks) C. Identify and label the start and stop codons on the mRNA sequence (2 marks) D. What is the sequence of the amino acids in the protein polypeptide encoded by the DNA shown above? Underline each codon and write the amino acid underneath each line. (4 marks